StudentShare
Contact Us
Sign In / Sign Up for FREE
Search
Go to advanced search...
Free

UCC and UCITA models acts - Essay Example

Cite this document
Summary
UCC and UCITA Model Acts Name Institution The first and most important attempts by the US government to promote uniformity in commercial laws from state to state was by the grant of power to congress under Article 8, Section 1, Clause 3 of the U.S. Constitution which was introduced in 1797…
Download full paper File format: .doc, available for editing
GRAB THE BEST PAPER94.5% of users find it useful
UCC and UCITA models acts
Read Text Preview

Extract of sample "UCC and UCITA models acts"

UCC and UCITA Model Acts The first and most important attempts by the US government to promote uniformity in commercial laws from state to state was by the grant of power to congress under Article 8, Section 1, Clause 3 of the U.S. Constitution which was introduced in 1797. This clause which is referred to as the “The Commerce Clause” gave power to congress “to regulate commerce with foreign Nations, and among the several States, and with the Indian Tribes” (U.S. House of Representatives 2004).

A significant challenge came in 1824 in the case of Gibbon vs. Ogden where Chief Justice Marshall interpreted the Power of Congress to regulate commerce and in the same breadth prohibited states from interfering with the flow of goods and services across state boundaries by passing laws (Find Law n.d.). Chief Justice Marshall indicated that the clause was not limited to interstate commerce but also intrastate commerce. Article 2 of the Uniform Commercial Code (UCC) refers to contracts for sale of goods (Cornell University Law School).

The article is limited in scope and does no cover computer information and internet contracting. It governs transactions in tangible goods and does not cover intangible items. Article 2 of the Uniform Computer Information Transactions Act (UCITA) was specifically created to deal with the deficiencies in the UCC. Article 2 of UCITA relates to intangible items such as licenses. According to UCITA Online (n.d) the Act states clearly that contracts relating to computer information are licenses and therefore involves a set of legal considerations that are not applicable to sale of tangible items.

The UCITA therefore established a clear set of rules relating to software licensing, online access and other transaction in computer information where none existed before UCITA Online (n.d.). Computer software though purchased with a computer has limitations and guidelines on how they are used. This license does not constitute a sale but allows the buyer of the license to use the information as agreed in the license and prohibits any misuse of the license. For example, when an application software such as Microsoft Office Suite is ‘purchased’, except where agreed the software can only be loaded unto a prescribed number of computers based on the license.

The license to use the software on one or more machines is purchased and not the software itself. The legal distinction between selling a product and licensing it is that a sale represents the transfer of title to good. The ownership of the item passes from the seller to the buyer who is now free to do just about anything with the good. In terms of a license it a right to use a trademark or a patent or in the case of the computer software – the right to use a program within certain guidelines outlined in the license.

The license really gives permission for the licensee to use information within certain pre-agreed terms and conditions. Before the licensee is able to use the product the agreement has to be accepted. Many of the provisions in the UCITA were first proposed as a modification to Article 2 of the UCC. It is my opinion that the drafters decided to propose a separate and distinct Act because of the difficulties in getting different groups in different states to accept the changes. Different groups have different levels of power in their relative states and so the changes would not have been forthcoming to the UCC.

UCITA as it is represents a model act that the states may choose to adopt as they please. References Cornell University Law School (2005). UCC: Article 2 – Sales. Retrieved from: http://www.law.cornell.edu/ucc/2/article2.htm Find Law (n.d.) U.S. Constitution Article 1. Retrieved from: http://caselaw.lp.findlaw.com/data/constitution/article01/28.html UCITA Online. (n.d.) UCITA Online: A Commercial Code for the Information Age? Retrieved from: http://www.ucitaonline.com/ U.S House of Representatives. (2004). The United States Constitution.

Retrieved from: http://www.house.gov/house/Constitution/Constitution.html

Read More
Cite this document
  • APA
  • MLA
  • CHICAGO
(“UCC and UCITA models acts Essay Example | Topics and Well Written Essays - 500 words”, n.d.)
Retrieved from https://studentshare.org/other/1427322-ucc-and-ucita-models-acts
(UCC and UCITA Models Acts Essay Example | Topics and Well Written Essays - 500 Words)
https://studentshare.org/other/1427322-ucc-and-ucita-models-acts.
“UCC and UCITA Models Acts Essay Example | Topics and Well Written Essays - 500 Words”, n.d. https://studentshare.org/other/1427322-ucc-and-ucita-models-acts.
  • Cited: 0 times

CHECK THESE SAMPLES OF UCC and UCITA models acts

UCC and the UCITA

?? Based on the information presented above, what do you see as the major differences between Article 2 of the Uniform Commercial Code and ucita?... Before the ucc and the UCITA, the U.... ?? Before the ucc and the UCITA, what was one of the first, and most significant, of the U.... Before the ucc and the UCITA, the U.... The ucita on the other hand extends to include transactions involving software.... Many of the provisions in the ucita were first proposed as a modification to Article 2 of the UCC....
2 Pages (500 words) Essay

Arbitration Law

ARBITRATION LAW By Course Instructor Institution 19, Mar 2012 PART A This scenario has elements of an investor –state arbitration, since Tourist Drivers Limited is fully owned by the state of Languada.... In a similar case, GSS Group v.... National Port Authority1 a case involving a corporation fully owned by the state of Liberia; the Court found that the corporation “is encompassed by the relevant statutory definition of the term, ‘foreign state'....
8 Pages (2000 words) Assignment

Comparison of The Uniform Commercial Code and UCITA

Business law: Before the ucc and ucita, what was one of the first, and most significant, of the U.... The National Conference of commissioners on uniform state laws (NCCUSL) on July 29 adopted Uniform Computer Information Transactions Act (ucita) after revising the proposals again and again.... ased on the information presented above, what do you see as the major differences between Article 2 of the Uniform Commercial Code and UCITAThe National Conference of commissioners on uniform state laws (NCCUSL) on July 29 adopted Uniform Computer Information Transactions Act (ucita) after revising the proposals again and again....
2 Pages (500 words) Essay

Distinction between UCC and UCITA

13 March 2007 ucc and ucita The major distinction between Uniform Computer Information Transactions Act (UCITA) approved by the National Conference of Commissioners on Uniform State Laws (NCCUSL) membership at its Annual Meeting in July 1999 and Uniform Commercial Code's (UCC) Article 2 is that UCC's Article 2 reflects conventional contract law and deals only with the sale of goods and it does not give any idea about the transfer rights to use computer information.... Transactions Act (ucita) approved by the National Conference of Commissioners on Uniform State Laws (NCCUSL) membership at its Annual Meeting in July 1999 and Uniform Commercial Code's (UCC) … Article 2 reflects conventional contract law and deals only with the sale of goods and it does not give any idea about the transfer rights to use computer information....
2 Pages (500 words) Essay

Unfair Terms in the Contracts and Exclusion of Liabilities

This paper “Unfair Terms in the Contracts and Exclusion of Liabilities” examines some of situations of fairness and certainty.... There are circumstances under which the courts have barred the use of a particular term of the contract simply because the term could be treated as an 'unfair' one....
62 Pages (15500 words) Essay

Assignment-Synthesis of a Protein

Sequence A: TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGT DNA: TCT/TCC/CTC/CTA/AAC/GTT/CAA/CCG/GTT/CTT/AAT/CCG/CCG/CCA/GGG/CCC/CGC/CCC/TCA/GAA/GTT/GGTmRNA:UCU/ucc/CUC/CUA/AAC/GUU/CAA/CCG/GUU/CUU/AAU/CCG/CCG/CCA/GGG/CCC/CGC/CCC/UCA/GAA/GUU/GGU66 nucleotides1 UCUUCCCUCC UAAACGUUCA ACCGGUUCUU AAUCCGCCGC CAGGGCCCCG 51 CCCCUCAGAA GUUGGUNote: The numbers 1 and 51 represent the nucleotide positions.... Example, at position 51, the nucleotide base is C or CytosineWhen codons 24 to 66, including codons 66 are removed, the sequence reads,UCUUCCCUCCUAAACGUUCAACC UCU/ ucc/ CUC/ CUA/ AAC/ GUU/ CAA/ CC Amino acid sequence: Serine (S)/ Serine (S)/ Leucine (L)/ Leucine (L)/ Aspargine (N)/ Valine (V) / Glutamine (Q)Therefore, resulting protein sequence is,SSLLNVQSequence B: TCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCATGAATCTCTTAACTDNA: TCA/GAC/GTT/TTT/GCC/CCG/TAA/CAA/CTT/GTT/ACA/ACA/TGG/TCA/TAA/ACG/TCA/GAG/ATG/GTC/ATG/AAT/CTC/TTA/ACTmRNA:UCA/GAC/GUU/UUU/GCC/CCG/UAA/CAA/CUU/GUU/ACA/ACA/UGG/UCA/UAA/ACG/UCA/GAG/AUG/GUC/AUG/AAU/CUC/UUA/ACU75 nucleotides1 UCAGACGUUU UUGCCCCGUA ACAACUUGUU ACAACAUGGU CAUAAACGUC 51 AGAGAUGGUC AUGAAUCUCU UAACUWhen codons 24 to 66, including codons 66 are removed, the sequence reads,UCAGACGUUU UUGCCCCGUA ACACUCUUAA CUUCA/ GAC/ GUU/ UUU/ GCC/ CCG/ UAA/ CAC/ UCU/ UAA/ CUAmino acid sequence: Serine (S)/ Aspartic acid (D)/ Valine (V) /Phenylalanine (F) / Alanine (A) / Proline (P)/ STOP CODON/Histidine (H)/ Serine (S)/ STOP CODONTherefore, resulting protein sequence is,SDVFAP....
2 Pages (500 words) Lab Report

Helicobacter Pylori as a Gram-negative Microaerophilic Bacterium

The paper "Helicobacter Pylori as a Gram-negative Microaerophilic Bacterium" states that potential use of probiotics as an alternative therapy for Helicobacter infection has generated a considerable amount of interest.... However, investigations are still in its infancy.... hellip; The two main thrusts in this research are to find whether the addition of probiotic results in any positive outcome when administered along with the therapeutic regimen and whether probiotics were able to ameliorate any adverse effect that may have to arise due to conventional therapeutic procedure....
7 Pages (1750 words) Coursework

Engineering Requirements for Coffee System and Drinks Machine Control System

… The paper “Engineering Requirements for Coffee System and Drinks Machine Control System” is a  meaningful variant of assignment on engineering.... The following UML use case diagram provides an overview of how the proposed drinks machine control system will function.... nbsp;In this scenario, the interaction is between four actors and the system which is also considered an actor....
8 Pages (2000 words) Assignment
sponsored ads
We use cookies to create the best experience for you. Keep on browsing if you are OK with that, or find out how to manage cookies.
Contact Us